Ward primer sequence (5-3) CGACCAGCGGTACAATCCAT TGGTGGGTCAGC TTCAGCAA TTCGCATGATAGCAGCCAGT GATGTTCTCGGGGATGCGAT TTGTGCAAGAGAGGGCCATT GCCACGACAGGT
Ward primer sequence (5-3) CGACCAGCGGTACAATCCAT TGGTGGGTCAGC TTCAGCAA TTCGCATGATAGCAGCCAGT GATGTTCTCGGGGATGCGAT TTGTGCAAGAGAGGGCCATT GCCACGACAGGT TTGTTCAG CCC TTGCAGCACAAT TCCCAGAG AGC TGCGATACC TCGAACG TCTCAACAATGGCGGCTGCTTAC GCAAACGCCACAAGAACGAATACG CAGATACCCACAACCACC TTGCTAG GTTCCCGAATAGCCGAGTCA TTGGCATCGTTGAGGGTC T Reverse primer sequence (5-3) CAGTGT TGGTGTACTCGGGG ATGGCATTGGCAGCGTAACG CAAACT TGCCCACACACTCG GGAATCACGACCAAGCTCCA GCTCCTCAACGGTAACACCT CAACCTGTGCAAGTCGCT TT GAATCGGCTATGCTCCTCACACTG GGTGCCAATCTCATC TGC TG TGGAGGAGGTGGAGGATT TGATG ACT TCAAGGACACGACCATCAACC TCCGCCACCAATATCAATGAC TTC TGGAGGAAGAGATCGGTGGA CAGTGGGAACACGGAAAGCJin et al. BMC Genomics(2022) 23:Web page 5 ofFig. 1 A Chloroplasts of tea leaves sprayed with brassinosteroids (BRs) for: A) 0 h displaying starch D3 Receptor drug grains (20,000. s: Starch granule. B Chloroplasts of tea leaves sprayed with brassinosteroids (BRs) for: B) three h showing starch grains (20,000. s: Starch granule. C Chloroplasts of tea leaves sprayed with brassinosteroids (BRs) for: C) 9 h showing starch grains (20,000. s: Starch granule. D Chloroplasts of tea leaves sprayed with brassinosteroids (BRs) for: D) 24 h displaying starch grains (20,000. s: Starch granule. E Chloroplasts of tea leaves sprayed with brassinosteroids (BRs) for: E) 48 h showing enlarged thylakoids, starch grains, and lipid globules (20,000. s: Starch granule; g: Lipid globulesGlobal expression profile analysis of tea leavesThe samples of fresh tea leaves treated with CAK (0 h soon after BR remedy) and distinct BR therapy durations (CAA, CAB, CAC, and CAD) were analyzed by RNASeq, and three independent repeats have been carried out. The average clean reads had been 6.89 Gb in length (Table two), and GC percentages ranged from 43.12 to 44.21 . The base percentage of Q30 ranged from 90.53 to 94.18 , indicating that the data obtained by transcriptome sequencing was of top quality. Around the basis of measuring the gene expression degree of every sample, a XIAP Formulation DEGseq algorithm was utilized to analyze the DEGs in fresh tea leaves treated with CAK (BRs for 0 h) and BRs for diverse durations (CAA, CAB, CAC, and CAD). The outcomes showed that compared with CAK (0 h BR treatment), CAA (spraying BR three h) had 1867 genes upregulated and 1994 genes downregulated. CAB (spraying BR for 9 h) had 2461 genes upregulated and 2569 genes downregulated. CAC (spraying BR for 24 h) had 815 genes upregulated and 811 genes downregulated. A total of 1004 genes have been upregulated and 1046 were downregulated when BRs have been sprayed for 48 h (CAC) compared with the 0-h BR therapy (CAK) (Fig. 2a). As might be observed in the Wayne diagram (Fig. 2b), there were 117 DEGs had been shared among all groups. Compared with CAK, upregulated and downregulated genes accounted for just about half of the 4 groups of treated samples. This may very well be because of the fast stimulation of the expression of some genes immediately after the exogenous spraying of BRs along with the consumption of some genes involved inside the tissue activities of tea leaves, resulting within the downregulation of expression. Amongst these, the total quantity of DEGs was the highest in CAB (the sample sprayed with BR for 9 h). The overall trend was that right after exogenous BR spraying, the total number of DEGs initially improved and after that sharply decreased. These integrated substantially upregulated genes that have been associated to BR signal transduction, cell division, and starch, sugar, and flavonoid metabolism such as starch-branching enzyme (BES), Cyc, granule-bound starch synthase (GBSS), sucro.
